Variant: rs1085307110

present in Gene: KY;CEP63;EPHB1 present in Chromosome: 3 Position on Chromosome: 134650909 Alleles of this Variant: -/ATGTCGATAGATACAGCACATGTCGATA

rs1085307110 in KY;CEP63;EPHB1 gene and Paraparesis, Spastic PMID 28488683 2017 Progressive hereditary spastic paraplegia caused by a homozygous KY mutation.

rs1085307110 in KY;CEP63;EPHB1 gene and Spastic Paraplegia PMID 28488683 2017 Progressive hereditary spastic paraplegia caused by a homozygous KY mutation.

rs1085307110 in KY;CEP63;EPHB1 gene and Spastic Paraplegia, Hereditary PMID 28488683 2017 Progressive hereditary spastic paraplegia caused by a homozygous KY mutation.