Variant: rs1555815437

present in Gene: SPTBN4 present in Chromosome: 19 Position on Chromosome: 40512839 Alleles of this Variant: -/AGCGGGCGGCGCGCATGACC

rs1555815437 in SPTBN4 gene and Dysmorphic features PMID 28540413 2017 A recessive mutation in beta-IV-spectrin (SPTBN4) associates with congenital myopathy, neuropathy, and central deafness.

PMID 23236289 2012 Recessive mutations in SPTBN2 implicate β-III spectrin in both cognitive and motor development.

PMID 11404407 2001 Drosophila alpha- and beta-spectrin mutations disrupt presynaptic neurotransmitter release.

PMID 10997877 2000 Prediction of the coding sequences of unidentified human genes. XVIII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro.

PMID 10811832 2000 Mutations in beta-spectrin disrupt axon outgrowth and sarcomere structure.

PMID 28940097 2017 Expanding the genetic heterogeneity of intellectual disability.

PMID 11528393 2001 Mutant beta-spectrin 4 causes auditory and motor neuropathies in quivering mice.

PMID 11807096 2002 [Beta]IV-spectrin regulates sodium channel clustering through ankyrin-G at axon initial segments and nodes of Ranvier.

PMID 23838597 2014 Autosomal dominant SCA5 and autosomal recessive infantile SCA are allelic conditions resulting from SPTBN2 mutations.

PMID 20493457 2010 Dominant-negative mutations in alpha-II spectrin cause West syndrome with severe cerebral hypomyelination, spastic quadriplegia, and developmental delay.

PMID 16429157 2006 Spectrin mutations cause spinocerebellar ataxia type 5.

PMID 23673272 2014 Spectrins: a structural platform for stabilization and activation of membrane channels, receptors and transporters.

PMID 22843192 2013 A family with spinocerebellar ataxia type 5 found to have a novel missense mutation within a SPTBN2 spectrin repeat.

PMID 11086001 2000 betaIV spectrin, a new spectrin localized at axon initial segments and nodes of ranvier in the central and peripheral nervous system.

rs1555815437 in SPTBN4 gene and Muscle hypotonia PMID 11404407 2001 Drosophila alpha- and beta-spectrin mutations disrupt presynaptic neurotransmitter release.

PMID 11807096 2002 [Beta]IV-spectrin regulates sodium channel clustering through ankyrin-G at axon initial segments and nodes of Ranvier.

PMID 16429157 2006 Spectrin mutations cause spinocerebellar ataxia type 5.

PMID 11528393 2001 Mutant beta-spectrin 4 causes auditory and motor neuropathies in quivering mice.

PMID 11086001 2000 betaIV spectrin, a new spectrin localized at axon initial segments and nodes of ranvier in the central and peripheral nervous system.

PMID 23673272 2014 Spectrins: a structural platform for stabilization and activation of membrane channels, receptors and transporters.

PMID 28940097 2017 Expanding the genetic heterogeneity of intellectual disability.

PMID 23838597 2014 Autosomal dominant SCA5 and autosomal recessive infantile SCA are allelic conditions resulting from SPTBN2 mutations.

PMID 28540413 2017 A recessive mutation in beta-IV-spectrin (SPTBN4) associates with congenital myopathy, neuropathy, and central deafness.

PMID 10811832 2000 Mutations in beta-spectrin disrupt axon outgrowth and sarcomere structure.

PMID 22843192 2013 A family with spinocerebellar ataxia type 5 found to have a novel missense mutation within a SPTBN2 spectrin repeat.

PMID 10997877 2000 Prediction of the coding sequences of unidentified human genes. XVIII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro.

PMID 20493457 2010 Dominant-negative mutations in alpha-II spectrin cause West syndrome with severe cerebral hypomyelination, spastic quadriplegia, and developmental delay.

PMID 23236289 2012 Recessive mutations in SPTBN2 implicate β-III spectrin in both cognitive and motor development.