Variant: rs863224229 

    present in Gene: SURF2;SURF1
    present in Chromosome: 9
    Position on Chromosome: 133356441
    Alleles of this Variant: ACCGCCGCCATCGCACCCGGCCCC/-

rs863224229 in SURF2;SURF1 gene and Cerebellar Ataxia PMID 27756633 2016 Identification of a novel deletion in SURF1 gene: Heterogeneity in Leigh syndrome with COX deficiency.

rs863224229 in SURF2;SURF1 gene and Kinetic tremor PMID 27756633 2016 Identification of a novel deletion in SURF1 gene: Heterogeneity in Leigh syndrome with COX deficiency.

rs863224229 in SURF2;SURF1 gene and Leigh Disease PMID 27756633 2016 Identification of a novel deletion in SURF1 gene: Heterogeneity in Leigh syndrome with COX deficiency.

rs863224229 in SURF2;SURF1 gene and Pediatric failure to thrive PMID 27756633 2016 Identification of a novel deletion in SURF1 gene: Heterogeneity in Leigh syndrome with COX deficiency.